tatyherrera40 tatyherrera40

23-09-2020
Mathematics

contestada

Round 2.8125 to the nearest hundred please help

Relax

Respuesta :

mykiahgriffiths mykiahgriffiths

23-09-2020

Answer:

2.81

Step-by-step explanation:

Answer Link

Otras preguntas

professor curie is using radioactive isotope Francium-223 in her research. the isotope has a half life of 22 minutes, which means that every 22 minutes the samp

PLZ HELP!!!!! WILL GIVE BRANLEAST!!!! Describe a time in the discussion when you asked or answered a question by using information you learned while you were pr

DEFICIENT of Vitamin B

Please show how you got that answer.

What is the slope of the line segment?

A television is sold for $825.50. The tax on the television is 8%. What will be the final price of the television?

What did they mean when they stated that women "were supposed to be happy housewives that stayed at home while "the Men" went to work? How were women "happy"?

First to answer gets brainlyist!!!!! hat way s iay our yay avorite fay ood fay?

Home work My first day in class 6

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT