HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!!

Transcribe the following DNA strand:
AAATACCCCGTAATGGCATAGGTCTGCACT

Relax

Respuesta :

Answer:

Transcription is the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA). During the process of transcription, each nitrogenous base is connected with it's pair, (Guanine and Cytosine)

(Adenine and Thymine)

However one must remember that RNA contains uracil instead of Thymine. Therefore whenever there is supposed to be a "T" on the MRNA strand, there will be a "U"

AAAGTCGCTCTGAGTTGTTAT 21    Depositors primer

Explanation: