stanblackpink3266 stanblackpink3266

25-09-2017
Health

contestada

A person has a genetic disease that prevents the phospholipids in the plasma membrane of the white blood cells from freely fusing with the other membranes within the cell. how would this disease affect phagocytosis?

Relax

Respuesta :

sarahgolts03 sarahgolts03

09-10-2017

The phagocytic vacuole wouldn't fuse with the lysosome.

Answer Link

Otras preguntas

What number is 64% of 90

Elaine bought a total of 15 shirts and pairs of pants. She bought 7 more shirts than pants. How many of each did she buy?

10(x+3)=9 mmmmmmmmmmmmmmmmm

If it takes 41.72 J to he a piece of gold waiting 18.69 g from 10.0°C to 27°C what is the specific heat of gold

What are two adjectives for the word Black hawk?

the sale price of a bicycle is $120 this is 75% of the original price find the original price

Describe the fluid theory of intelligence; then explain your views on the theory

Which is not an improper fraction equal to eight

Describe an internal characteristic that is similar in all people, but slightly different from person to person.

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC