shawny1317 shawny1317
  • 23-01-2024
  • Mathematics
contestada

Perform the requested operation or operations. (f(x) = {{x - 3}}/{5}), (g(x) = 5x - 3), find (g(f(x))).
a) ({{x - 3}}/{5})
b) (x - 3)
c) (x + 3)
d) (5x - 4)

Relax

Respuesta :

Otras preguntas

50 POINTS!!! Which function is a job responsibility of a counterintelligence agent? conducting investigations to detect and counter terrorist threats OB. identi
An individual has a disease that reduces the amount of hemoglobin in the blood. Which of the following is most likely true of this individual? a. Oxygen delive
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
female with normal color vision with a father who is colorblind
How do political parties help people become involved in the political process………….
What is the 13 times table?
what is another meaning for boredom
In your own words describe how mountains are formed at both convergent plate boundaries and divergent plate boundaries.
solve the system by substitution -5x+3y=2 y=2x
URGENT !!!!!!!!! 10 Haiku-uri despre iarna, va rog. Repede!!!