adam2287 adam2287

22-05-2022
Biology

contestada

Sensory ___ respond to stimuli by sending messages to the brain A. Nerve cells, or , are the basic units of the nervous system

Relax

Respuesta :

geekout234 geekout234

22-05-2022

Answer:

Sensory _____________ respond to stimuli by sending messages to the brain A.

Organs

Nerve cells, or __________ , are the basic units of the nervous system.

Neurons

Answer Link

Otras preguntas

The graphs below show measurements from cubes with different side lengths. A 24 8 Perimeter of 1 Face 16 12 4 40 36 32 828 1 3 Side Length 2 4 M Which pairs of

2 x APB BOQ - AOQ 2 - 2x2 Уг - x2) ХАРВ АРВ 32° Fig 0 W

Calculate SS, variance, and standard deviation for the following population of N = 8 scores: 1, 3, 1, 10, 1, 0, 1, 3. (Note: The computational formula works wel

En cada uno de los vértices de un triángulo equilátero 30 cm de lado se encuentran cargas de 5 × 10-8 C, 8 x 10-8 C y -4 x 10-8 C. Calcular: La energia potenci

Dos cajas de 15kg y 20 kg se mueven sobre un plano inclinado con fricción como lo muestra la siguiente imagen. Calcula la aceleración de las cajas y la tensión

Solve the application problem. In one day a baker used 2/3 of a pound of flour, then 3/4 of a pound of flour, then 5/12 of a pound of flour. How much flour was

Religion & Life Homework- (1) how does golden rules link to the idea of stewardship

follow me for more questions with high points

draw a scaled copy of the figure using a scale factor of 3/2

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I