Seudónimo Seudónimo

26-01-2017
Biology

contestada

What is the effect of bacteria, fungi, worms and insects making their soil their
home in the soil?

Relax

Respuesta :

26-01-2017

Soil inhabiting decomposers improve soil tilth, make nutrients more available
to plants, and recycle nutrients in an ecosystem, some fungi form mycorrhizas...

Answer Link

NataliaD1 NataliaD1

29-01-2017

It is helpful to plants and the ground (soil ) help us live

Answer Link

Otras preguntas

The value of Kp for the reaction below is 3.800 x 10° at 75°C. NO(g) + O₂(g) — NO₂(g) 7th attempt Il See Periodic Table See Hin At equilibrium, what is the rati

Find the value of k, if x = 2k-1, y = k is a solution of 3x -5y=7

The equation: s=p2−p2 gives the number of handshakes, s, that would take place when p people gather in a room and every person in the room shakes the hand of ev

people hate me but they clap for me what am I ??

What would you find if you compared and contrasted a textbook and an academic journal article in the same field?

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I

if 5/8 of a school is boys then what is the ratio of boys to girls

Complete the pattern: 9 + 6 = 9,000,000 + + 600 = 1,500 15,000,000

whats the answer ?????? simplify 5x5squared

On the directed line segment fam R to S on the coordinate plane above, what are the coordinates of the point that partitions the segment in the ratio 2 to 3?