prantocollo prantocollo

23-10-2020
Biology

contestada

What sequence below is the correct order (direction) bases will be added to the DNA strand below? *

Captionless Image

TAG-GTC

CTG-GAT

GCT-TGC

TAT-CAT

What sequence below is the correct order direction bases will be added to the DNA strand below Captionless ImageTAGGTCCTGGATGCTTGCTATCAT class=

Relax

Respuesta :

sgblu06 sgblu06

23-10-2020

Answer: TAG-GTC

Explanation: C always bonds to G. A way to remember is Cars go in the Garage. A always bonds to T in a DNA strand. A way to remember is Apples grow on trees.

Answer Link

Otras preguntas

Please send only answer Want to bring a metal rod to assemble a toy frame. All long metal rods must be used at least. How much to assemble the frame as shown in

Determine the boiling point of a solution that contains 150.0 g of naphthalene (C10H8, molar mass = 128.16 g/mol) dissolved in 950 mL of benzene (d = 0.877 g/mL

A study examined the relationship between having a baccalaureate degree and passing a cultural competency exam among a group of 987 randomly selected registered

You are studying nuclear lamins and use recombinant DNA technology to alter the coding sequence of a nuclear lamin gene. The alteration you make creates a situa

What is the sum of the angles 'a' and 'b' from the diagram below.

Please help me! I will give brainly! A law in Washington, D.C., restricts a new building's height to no more than 20 feet taller than the width of the street it

HELPPPPPPPPPPP PLEASEEEEEEEEEEEComplete this sentence. The solubility of a sample will ____________ when the size of the sample increases. stay the same decreas

which of the following is a double layer of phospholipds with proteins

bRamapo Company produces two products, Blinks and Dinks. They are manufactured in two departments, Fabrication and Assembly. Data for the products and departmen

A federal statute prohibits discrimination based on age for all persons between the ages of 50 and 70 in matters relating to employment. A state constitutional