jaysuarez654 jaysuarez654
  • 22-10-2020
  • Mathematics
contestada

The width of a rectangle is 2 more than a quarter the length, if L represents the length, which equation can be used to find the width, W?

Relax

Respuesta :

arycka arycka
  • 22-10-2020

Answer:

w - 2 = 1/4 l

w = 1/4 l + 2

Step-by-step explanation:

w = 1/4 l + 2

Answer Link

Otras preguntas

HURRY!! will mark brainliest and 15pts!! The volume of the composite figure is BLANK cubic centimeters ???HURRY!!​
15. Which of the following BEST defines the big bang? In several brief shocks, the Milky Way was placed into movement The Earth started to rotate around the Sun
what is the outcome for earth after the moon rotates around it?
Extra credit how many solutions
What is a hypothesis in statistics?
what Major adaptations necessary for survival are in the temperate rain forest
A few women joined the military as soldiers. How were they able to join?
4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please
Which statement explains how commercial land use negatively impacts watersheds? Chemicals in fertilizers run off into water and cause algae blooms. Production o
Sound travels at 340 m/s in dry air at room temperature. What is the wavelength of sound waves with a frequency of 880 Hz under those conditions?