montgomerybunston montgomerybunston

22-09-2020
Biology

contestada

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Relax

Respuesta :

oceanbluewater3000 oceanbluewater3000

22-09-2020

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

Answer Link

Otras preguntas

What is republican institution and how did the Northwest Ordinance extend republican institution into new territories?

What area of Egypt is known as “upper egypt” A- The northern area B- The Southern area C- The eastern area D- The western area

hi. Can you write me an essay about an e-mail that I describe my home and my family?

A baseball team has home games on Thursday and Saturday. The 2 games together earn $4339 for the team. Thursday's game generates $121 less of in Saturday. How m

can someone help me my home work is due tomorrow!!

Jerome is writing a coordinate proof to show that the midsegment of a trapezoid is parallel to its bases. He starts by assigning coordinates as given, where RS

what is one major similarity between the Battle of Verdun and the battle of battle of the somme

Plz help me get the answer ASAP

helps it’s algebra 2!! asap plz

How do I set up this problem?