luvxmimi luvxmimi
  • 23-04-2020
  • Biology
contestada

Create the complement of the following DNA strand. TACCCATTACGCGGCAAGCGUAATTAC​

Relax

Respuesta :

Аноним Аноним
  • 23-04-2020

Answer:

This is the mRNA strand

Explanation:

AUGGGUAAUGCGCCUUCGCAUUAAUG

Answer Link
StephanyNo StephanyNo
  • 23-04-2020
AUGGGUAAUGCGCCGUUCGCAUUAAUG
Answer Link

Otras preguntas

How are the decimals 0.009 and 0.09 related? Explain
Max drove 460 miles in 8 hours at a constant speed. How long would it take him to drive 661.25 miles at that speed
What kinds of scientific investigations involve making observations?
(9/16)^−1/2 How do I solve this equation?
7 more than twice a number x
The value of 7 in the 26475 is _ times the value of 7 in 503497
can a n oligarchy include representative and democracy
Which component is an example of skill-related fitness?
(3x10)x8=___x(10x8) complete equation and tell which properties were used
Find the quotient -7 divided by 14/3