llamacornatk
llamacornatk llamacornatk
  • 21-11-2019
  • Arts
contestada

what am i saying ❤ if you correct your not dumb

Relax

Respuesta :

roccotrovato126 roccotrovato126
  • 21-11-2019
u r saying Heart thanks make brainliest
Answer Link
jamsin75
jamsin75 jamsin75
  • 21-11-2019
Love You were saying that because you put the heart emoji
Answer Link

Otras preguntas

how are the four earths systems connected
Eleven members of the Middle School Math Club each paid the same amount for a guest speaker to talk about problem solving at their math club meeting. They paid
how to get the answer to this equation 1+4=5 2+5=12 3+6=21 8+11=?
the expression 4X gives the perimeter of a square with a side length of X units. what is the perimeter of a square with a side length of 5/7 units?
ratio of 6 to 4 is equal to
10(x+3)=9 mmmmmmmmmmmmmmmmm
What two countries on opposite sides of the ring of fire were shaken by major earthquakes last weekend
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Sharp pain is transmitted through which type of nerve fibers?
What impact did Babe Ruth have on the society/country?