bricenshepard bricenshepard

24-09-2019
Social Studies

contestada

The practice of negotiating labor contracts is known as a closed shop.

Question 16 options:
True
False

Relax

Respuesta :

caitlynj051 caitlynj051

24-09-2019

Answer:

False

Explanation:

A labor union contract is considered as the agreement of the collective bargaining.

Answer Link

Otras preguntas

Explain why 2.15 and -2.15 are are opposites?

Convert 2x - 3y + 1 = 0 to slope-intercept form

An ovule can be defined as:

What does Holden have against bald men?

The election of 1800 demonstrated that the Alien and Sedition Acts were constitutional. the electoral college worked smoothly. the US government was stable. pre

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Pedro tapes a 3 5/6 piece of paper to a 2 3/4 inch of piece with no overlap. how long is the piece of paper he made?

Discuss the consequences of poor wound management.

What might "tangible artifacts" tell us about the Shang?

Discuss at least two effects on U.S. citizens that stem from the division of power between the federal and state governments.