sybil84 sybil84

25-09-2018
Mathematics

contestada

six years ago,brett bought 1,525 worth of cell phone company since then the value of the stock has decreased at an average rate of 26.80 per year how much is the stock worth now

Relax

Respuesta :

Аноним Аноним

25-09-2018

Im guessing 40,870? hope this helps

Answer Link

Otras preguntas

How would you describe the speaker and her relationship with the character Death?

Use the correct indirect object pronoun as well as the correct form of the verb to complete the sentence. A ti y a mí ocho dólares. (quedar)

Whut is the answer? 2(98x3)

The basic concepts of financial management are the same for all businesses, regardless of how they are organized. However, a firm's legal structure affects its

What year did the Panama Canal officially connect the Pacific and Atlantic Seas?

HELP ASAP GIVING BRSINLIST

(9x3 - 2x2 - 3) - (4x3 - 9x + 6)

4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please

What are the two variables that affect the electric force between two objects?

A substance has a pH of 7. Which of the following descriptions matches this pH? A. It is very acidic. B. It is very basic. C. It is slightly basic. D. It is neu