Queenquestion3287 Queenquestion3287

26-03-2024
Biology

contestada

African elephants flap their large ears to cool off. which biology theme does this phenomenon represent?
a. continuity and change
b. relationship of structure to function
c. energy transfer

Relax

Respuesta :

Otras preguntas

6. Why is crossing over, or recombination, in meiosis a genetic advantage for a n organism? Why is crossing over an advantage for a geneticist

Sarabeth ran 1 2/5 miles on a path around the park. This was 5/8 of the distance around the park. What is the distance around the park.

Circle the preposition in these sentences We were exhausted because our flight arrived at 4am.

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Does old age means end of life according to A Tennyson in Ulysses

What is the significance of the similar number and arrangement of bones in a human arm and a bat wing?

what mass of iron 3 chloride contain 2.35 x 10 to the 23rd chloride ions

0-4+7-5×3÷9×5-4 do the sum of that mathematics...

which branch of central government makes/enact/ passes laws

What's a simple method to find the cube root of a number ?