gp742173 gp742173
  • 26-10-2022
  • Mathematics
contestada

A store buys 17 sweaters for $68 and sells them for $561. How much profit does the store make per sweater?

Relax

Respuesta :

Otras preguntas

Write your question here (Keep it simple and clear to get the best answer)what are the different types of bleaching agent's
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Who is Barbare Sonek?
what is 7/8ths of 40
Juliana’s exercise partner is running a high fever and feels nauseous. She also has a rapid heart rate. What should Juliana do? Get warm food Stay in the sun
What do they mean when they say, "Society pays for the end results of alcohol abuse"? Do they mean that the person who consumed it pays the consequences or lite
2. Students are asked to sequence the order of the seasons using picture cards. Which group of students sequenced their picture cards correctly? winter summer s
Which one of the following statements expresses a true proportion? A. 2 : 3 = 3 : 2 B. 3 : 5 = 12 : 20 C. 42 : 7 = 6 : 2 D. 14 : 6 = 28 : 18
what would you use chromatography for?
louine bought a computer for 180$ and paid 10.80$ what percent of the cost is the sales tax? (Please help and explain)