tryjenjas
tryjenjas tryjenjas
  • 22-04-2021
  • Mathematics
contestada

can someone give me a graph

can someone give me a graph class=
Relax

Respuesta :

amoridavis amoridavis
  • 22-04-2021

Answer:

line plot

Step-by-step explanation:

draw your graph out

Answer Link
nathaliapaige nathaliapaige
  • 22-04-2021
it’s a line plot ^ she’s right
Answer Link

Otras preguntas

DNA tacaggtacccgaacccaattta
What’s 16 divided by 1312
PLEASE HELp WITH Question 6
HURRY, ASAP!!! Identify the type of irony in the following scenario: (1 point) Helen wakes up late on Monday morning and barely makes the school bus. The only s
How does the depictions of the characters from the text compared to the films depiction of the characters in the yellow paper
A farmer can harvets 2 1/3 acres of corn in 1 day. How many days will it take to harvest 10 1\2 acres
When infants attempt to imitate an adult's action (e.g., smile, hand clapping, sound), they are less likely to mature into unique individuals.​ True False
Which of the equations below could be the equation of this parabola?
What made Cumberland Road important during the 19th century? It was the first time stones were used as a surface. It was the first time a road went to many town
small business owners usually invest little money into new marketing strategies because