24-02-2021
Mathematics

contestada

59 + 4/9y
y= -1/2
Thank you

Relax

Respuesta :

Аноним Аноним

24-02-2021

Answer:

=

4 /9 y+59

Step-by-step explanation:

Answer Link

BloodySoulzz BloodySoulzz

24-02-2021

Answer: 58.78 or 58 and 7/9ths

Step-by-step explanation:

59+4/9(-1/2), 59-2/9=58.78 or 58 and 7/9ths

Answer Link

Otras preguntas

Why did christianity spread throughtout the roman empire

what kind of polls might journalists use to assess how voting has gone during an election A: Push polls B: Query polls C: Exit polls D: District polls

I really need help, will give brainliest please help ASAP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

how does the attitude of Colonel Robert Shaw towards blacks change and why?

What does the image above show? What would be its purpose in animation?

Choose the correct plural and singular and plural possessive forms of the word below. Singular Form: Mrs. Gonzales

Please Help!! I really wanna get a good grade!! Ok have a great day!

DNA tacaggtacccgaacccaattta

Explain how to divide i still don't understand

Can someone please explain how to find x and y I don’t understand this at all